Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation

Journal: Frontiers in Cell and Developmental Biology

Article Title: Autophagy Drives Galectin-1 Secretion From Tumor-Associated Macrophages Facilitating Hepatocellular Carcinoma Progression

doi: 10.3389/fcell.2021.741820

Figure Lengend Snippet: Gal-1 secretion is mediated by autophagy. (A) BMDMs were pretreated with 3MA (2 mM) or Brefeldin A (30 nM) for 1 h and then treated with MCM for another 24 h. The expression of cytosolic LC3-I/II, β-actin, and supernatant G-1 proteins was determined by Western blotting. All blots were derived from a single experiment. (B) BMDMs were treated with MCM for 12 h and stained with anti-LC3 antibody. The LC3 aggregation (green) was observed by confocal microscopy. Scale bar = 10 μm. (C) RAW 264.7 cells stably expressing luciferase (Luc) or Atg5 shRNA were treated with MCM for 24 h. The expression of cytosolic Atg5, β-actin, and supernatant Gal-1 proteins was determined by Western blotting. All blots were derived from a single experiment. (D) RAW264.7 cells were transfected with control or Stx17 siRNA at 10 μM for 24 h and then treated with MCM for another 24 h. The expression of cytosolic Gal-1, Stx17, p62, β-actin, and supernatant Gal-1 proteins was determined by Western blotting. All blots were derived from a single experiment. (E) BMDMs were treated with MCM for 12 h and stained with anti-Gal-1 (green) and -LC3 (red) antibodies. The distribution of these proteins was analyzed by confocal microscopy. Scale bar = 10 μm. (F) BMDMs were treated with MCM for 6 h to detect Gal-1 by immunoelectron microscopy. Gold nanoparticle-labeled Gal-1 (arrow bead) in the autophagosomes was observed under a transmission electron microscope. Scale bar = 60 nm. (G) RAW 264.7 cells were treated with MCM for 6 h to isolate autophagosomes. The expression of calreticulin, HSP60, LC3-I/II, and Gal-1 proteins in different cell components was determined by Western blotting. WCL: whole cell lysates; PNS: post-nuclear supernatants; AP: autophagosomes. All blots were derived from a single experiment. (H) WT and Atg5-/- MEF cells were transfected with Gal-1-GFP to monitor the Gal-1 trafficking by TIRF microscopy. Selected frames from time-lapse TIRF microscopy with time intervals in seconds are shown. The protein expression of Atg5 of WT and Atg5-/- MEFs was determined by Western blotting (bottom right corner). All blots were derived from a single experiment.

Article Snippet: Antibodies against Gal-1, Stx17, CD63, Rab11, VAMP7, calreticulin, heat shock protein 60 (HSP60), and β-actin were purchased from Abcam (Cambridge, United Kingdom).

Techniques: Expressing, Western Blot, Derivative Assay, Staining, Confocal Microscopy, Stable Transfection, Luciferase, shRNA, Transfection, Control, Immuno-Electron Microscopy, Labeling, Transmission Assay, Microscopy

Journal: Cell reports

Article Title: Interaction between host G3BP and viral nucleocapsid protein regulates SARS-CoV-2 replication and pathogenicity

doi: 10.1016/j.celrep.2024.113965

Figure Lengend Snippet:

Article Snippet: Human: Calu3-2b4 , ATCC , RRID: CVCL_YZ47.

Techniques: Virus, Recombinant, Protease Inhibitor, Electron Microscopy, Lysis, Extraction, Staining, Mutagenesis, Software

Journal: Nature Communications

Article Title: SuPAR mediates viral response proteinuria by rapidly changing podocyte function

doi: 10.1038/s41467-023-40165-5

Figure Lengend Snippet: a Experimental scheme. I/N, intranasal ( n = 8 mice per group, all male). The illustrations of SARS-Cov-2 and mouse were created with BioRender.com. b Proteinuria. 2019-nCov spike S1 protein inoculation induced proteinuria in mouse soluble urokinase receptor transgenic (suPAR-Tg) mice, but not in wild-type B6, or mouse urokinase receptor (uPAR) deficiency ( Plaur −/− ) mice ( n = 8 per group, male). Alb albumin. Creat creatinine. c Transmission electron microscopy (TEM) analyses. TEM images showing glomerular filtration barrier and foot process effacement (red arrow). Representative of ten images per group. Blue scale bar, 1 μm . d Foot process count per μm GBM. FP foot process. GBM glomerular basement membrane ( n = 10 replicates per group). e Blocking suPAR with uPAR monoclonal antibody (Mab) as shown in treatment scheme reduced proteinuria in male suPAR-Tg mice upon 2019-nCov spike S1 protein inoculation ( n = 6 per group). IgG isotype IgG control. D day. f Vaccination with single dose BNT162b2 as shown in the treatment scheme prevented 2019-nCov spike S1 protein induced proteinuria in male suPAR-Tg mice ( n = 6 per group). Saline, phosphate-buffered saline (PBS). q.d. once a day, I.M, intramuscular. I/N, intranasal. In ( b ), ( e ) and ( f ), two-way analysis of variance with Tukey’s multiple comparisons test was conducted. d One-way analysis of variance with Tukey’s multiple comparisons test was performed. Data are presented as mean ± SD. *** P < 0.001, **** P < 0.0001.

Article Snippet: In particular, peripheral blood was drawn before vaccination (day 0), on day 7, 11, 22 post vaccination to monitor the titer of IgG antibody to spike RBD protein with GENLISA mouse anti-SARS-CoV-2 (COVID-19) IgG antibody to spike RBD protein Quantitative TITRATION ELISA kit (Krishgen Biosystems).

Techniques: Transgenic Assay, Transmission Assay, Electron Microscopy, Filtration, Blocking Assay

Journal: Frontiers in Microbiology

Article Title: The role of SIRT1 in the process of Toxoplasma gondii infection of RAW 264.7 macrophages

doi: 10.3389/fmicb.2022.1017696

Figure Lengend Snippet: Intracellular growth of RH tachyzoites with SRT1720 and EX527 in vitro . RH tachyzoites were harvested to infect RAW 264.7 mouse macrophages at an infection ratio of 5:1 (parasite/host cell) for 2 h, followed by the removal of excess parasites and stimulation with SRT1720 (5 μM) and EX527 (10 μM) for 24 h and further examination by staining with Wright's stain. RAW 264.7 cells stimulated with SRT1720 (5 μM) and EX527 (10 μM) for 2, 6, 12, or 18 h were collected and further examined by transmission electron microscopy (TEM) or lysed for Western Blot. We adjusted the protein concentration of each group of samples to be consistent and then carried out the experiment. Anti-SIRT1 antibody and anti-beta-Actin antibody were used at a 1:1,000 dilution. (A) T. gondii infection upregulated SIRT1 levels in host cells over time. Infected macrophages treated with SRT1720 exhibited an upregulation of SIRT1 at 2 and 18 h compared to that for the T. gondii infection group. Infected macrophages treated with EX527 showed a downregulation of SIRT1 at 2 and 18 h, compared to that for the T. gondii infection group. (B) A scattered distribution chart reveals the mean intracellular tachyzoite counts. Values represent actual numbers (scattered dots) and means (black lines) from three independent experiments; in each experiment, at least 200 infected cells were counted. The average number of T. gondii tachyzoites in macrophages stimulated by EX527 was significantly reduced compared to the control group. The average number of tachyzoites in the control group was about 10, while the average number of tachyzoites in the EX527 group dropped to about 5. T.g, T. gondii tachyzoites *** P < 0.001. The infected macrophages treated with SRT1720 had a much heavier intracellular tachyzoite burden than those incubated with EX527. (C) The number of T. gondii tachyzoites in the cell increased with the duration of the infection. At the same time, compared with the control group, the group with SRT1720 addition had more intracellular T. gondii tachyzoites. In contrast, the EX527 stimulation group had fewer intracellular T. gondii tachyzoites than the control group. These results were obtained from three independent experiments. The values shown are the means ± SEM from three independent experiments. RH, T. gondii RH strain. *** P < 0.001.

Article Snippet: The following reagents and equipments were used in the studies: SRT1720 (hydrochloride) (CAS No.: 1001645, MCE, USA), EX527 (CAS No.: 49843-98-3, MCE, USA), Rapamycin (CAS No.: 53123-88-9, MCE, USA), recombinant Interferon-γ (Cat. No.: I4777, Sigma-Aldrich, USA), recombinant mouse TRAP/CD40L protein (Active) (ab220551, Abcam, USA), anti-SIRT1 antibody [SirT1 (1F3) Mouse mAb #8469, Cell Signaling Technology, USA], anti-LC3 antibody [LC3A/B (D3U4C) XP Rabbit mAb #12741, Cell Signaling Technology, USA], anti-mTOR antibody [mTOR (7C10) Rabbit mAb #2983, Cell Signaling Technology, USA], anti-Phospho-mTOR antibody [Phospho-mTOR (Ser2448) (D9C2) XP Rabbit mAb #5536, Cell Signaling Technology, USA], anti-IRGM1 antibody [IRGM (E6P7W) Rabbit mAb #71950, Cell Signaling Technology, USA], anti-beta-Actin mouse monoclonal antibody (Cat. No.: T0022, Affinity, China), LysoTrackerTM Red DND-99–Special Packaging (Cat. No.: L7528, Thermo Fisher, USA), ProLong Gold Antifade Mountant with DAPI (Cat. No.: P36935, Thermo Fisher, USA), Goat anti-Mouse Alexa Fluor 488 (Cat. No.: A-11017, Thermo Fisher, USA), microplate reader (Sunrise, TECAN, Switzerland), Confocal Microscope (LSM 710, Zeiss, Germany), and Transmission Electron Microscope (TEM) (HT7800, Hitachi, Japan).

Techniques: In Vitro, Infection, Staining, Transmission Assay, Electron Microscopy, Western Blot, Protein Concentration, Control, Incubation

Journal: Frontiers in Microbiology

Article Title: The role of SIRT1 in the process of Toxoplasma gondii infection of RAW 264.7 macrophages

doi: 10.3389/fmicb.2022.1017696

Figure Lengend Snippet: Intracellular growth of RH tachyzoites inside mouse macrophages with regulation by Sirtuin 1 (SIRT1) and interferon gamma (IFN-γ) or CD154 at different time points. RAW 264.7 macrophages were either infected with RH tachyzoites at a ratio of 5:1 (parasite/host cell) for 2 h or left in the culture plate without infection, followed by incubation with IFN-γ (1 μg/ml), CD154 (200 ng/ml), IFN-γ (1 μg/ml) and SRT1720 (5 μM), IFN-γ (1 μg/ml) and EX527 (10 μM), CD154 (200 ng/ml) and SRT1720 (5 μM), or CD154 (200 ng/ml) and EX527 (10 μM) for 24 h. Before observation under light microscopy. (A) Observation under light microscopy pointed out that the infected macrophages had much heavier intracellular tachyzoite burdens than infected macrophages incubated with IFN-γ at 24 h after infection. SRT1720 neutralized the intracellular tachyzoites' downward trend caused by IFN-γ, while EX527 enhanced the downtrend. (B) Observation under a light microscope revealed that the infected macrophages had much heavier intracellular tachyzoite burdens than infected macrophages incubated with CD154 at 24 h after infection. SRT1720 neutralized the intracellular tachyzoites' downward trend caused by IFN-γ, while EX527 enhanced the downtrend. (C) A scattered distribution chart showing the means of the intracellular tachyzoite counts. Values represent actual numbers (scattered dots) and means (black line) from three independent experiments; in each case, at least 200 infected cells were counted. *** P < 0.001.

Article Snippet: The following reagents and equipments were used in the studies: SRT1720 (hydrochloride) (CAS No.: 1001645, MCE, USA), EX527 (CAS No.: 49843-98-3, MCE, USA), Rapamycin (CAS No.: 53123-88-9, MCE, USA), recombinant Interferon-γ (Cat. No.: I4777, Sigma-Aldrich, USA), recombinant mouse TRAP/CD40L protein (Active) (ab220551, Abcam, USA), anti-SIRT1 antibody [SirT1 (1F3) Mouse mAb #8469, Cell Signaling Technology, USA], anti-LC3 antibody [LC3A/B (D3U4C) XP Rabbit mAb #12741, Cell Signaling Technology, USA], anti-mTOR antibody [mTOR (7C10) Rabbit mAb #2983, Cell Signaling Technology, USA], anti-Phospho-mTOR antibody [Phospho-mTOR (Ser2448) (D9C2) XP Rabbit mAb #5536, Cell Signaling Technology, USA], anti-IRGM1 antibody [IRGM (E6P7W) Rabbit mAb #71950, Cell Signaling Technology, USA], anti-beta-Actin mouse monoclonal antibody (Cat. No.: T0022, Affinity, China), LysoTrackerTM Red DND-99–Special Packaging (Cat. No.: L7528, Thermo Fisher, USA), ProLong Gold Antifade Mountant with DAPI (Cat. No.: P36935, Thermo Fisher, USA), Goat anti-Mouse Alexa Fluor 488 (Cat. No.: A-11017, Thermo Fisher, USA), microplate reader (Sunrise, TECAN, Switzerland), Confocal Microscope (LSM 710, Zeiss, Germany), and Transmission Electron Microscope (TEM) (HT7800, Hitachi, Japan).

Techniques: Infection, Incubation, Light Microscopy

Journal: Frontiers in Microbiology

Article Title: The role of SIRT1 in the process of Toxoplasma gondii infection of RAW 264.7 macrophages

doi: 10.3389/fmicb.2022.1017696

Figure Lengend Snippet: Murine ortholog of immunity-related GTPase family M (IRGM1) regulation by Sirtuin 1 (SIRT1) with or without interferon gamma (IFN-γ) or CD154 at different time points. RAW 264.7 macrophages were either infected with RH tachyzoites at a ratio of 5:1 (parasite/host cell) for 2 h or left in the culture plate without infection, followed by incubation with IFN-γ (1 μg/ml), CD154 (200 ng/ml), SRT1720 (5 μM), EX527 (10 μM), IFN-γ (1 μg/ml) and SRT1720 (5 μM), or IFN-γ (1 μg/ml) and EX527 (10 μM) for 2, 18, or 24 h before the collection of the cell lysates. We adjusted the protein concentration of each group of samples to be consistent and then carried out the experiment. Anti-IRGM1 antibody and anti-beta-Actin antibody were used at a 1:1,000 dilution. (A) The expression of IRGM1 in the Toxoplasma gondii infection group increased at 2 h but decreased at 18 and 24 h compared to that for the control group. Infected macrophages treated with IFN-γ displayed an upregulation of IRGM1 at 2, 18, and 24 h compared to that of the infection-only group. (B) Infected macrophages treated with CD154 showed no significant changes of IRGM1 compared to that for the infection-only group. (C) Infected macrophages treated with RH tachyzoites showed an upregulation of IRGM at 2 h and a downregulation at 18 or 24 h compared to that of the control group. Meanwhile, IRGM1 production was found to be decreased under SRT1720 stimulation and increased with the existence of EX527 at 2 h. However, both SRT1720 and EX527 failed to interfere with the IRGM1 level at 18 and 24 h. (D) When combining SIRT1 interference and IFN-γ stimulation, infected macrophages treated with IFN-γ and SRT720 showed a downregulation of IRGM at 2, 18, and 24 h compared to that of the IFN-γ group. Meanwhile, infected macrophages treated with IFN-γ and EX527 showed an upregulation of IRGM at 2, 18, and 24 h compared to that of the IFN-γ group. These results were obtained from three independent experiments. RH, T. gondii RH strain. * P < 0.05, ** P < 0.01, and *** P < 0.001.

Article Snippet: The following reagents and equipments were used in the studies: SRT1720 (hydrochloride) (CAS No.: 1001645, MCE, USA), EX527 (CAS No.: 49843-98-3, MCE, USA), Rapamycin (CAS No.: 53123-88-9, MCE, USA), recombinant Interferon-γ (Cat. No.: I4777, Sigma-Aldrich, USA), recombinant mouse TRAP/CD40L protein (Active) (ab220551, Abcam, USA), anti-SIRT1 antibody [SirT1 (1F3) Mouse mAb #8469, Cell Signaling Technology, USA], anti-LC3 antibody [LC3A/B (D3U4C) XP Rabbit mAb #12741, Cell Signaling Technology, USA], anti-mTOR antibody [mTOR (7C10) Rabbit mAb #2983, Cell Signaling Technology, USA], anti-Phospho-mTOR antibody [Phospho-mTOR (Ser2448) (D9C2) XP Rabbit mAb #5536, Cell Signaling Technology, USA], anti-IRGM1 antibody [IRGM (E6P7W) Rabbit mAb #71950, Cell Signaling Technology, USA], anti-beta-Actin mouse monoclonal antibody (Cat. No.: T0022, Affinity, China), LysoTrackerTM Red DND-99–Special Packaging (Cat. No.: L7528, Thermo Fisher, USA), ProLong Gold Antifade Mountant with DAPI (Cat. No.: P36935, Thermo Fisher, USA), Goat anti-Mouse Alexa Fluor 488 (Cat. No.: A-11017, Thermo Fisher, USA), microplate reader (Sunrise, TECAN, Switzerland), Confocal Microscope (LSM 710, Zeiss, Germany), and Transmission Electron Microscope (TEM) (HT7800, Hitachi, Japan).

Techniques: Infection, Incubation, Protein Concentration, Expressing, Control

Journal: Frontiers in Microbiology

Article Title: The role of SIRT1 in the process of Toxoplasma gondii infection of RAW 264.7 macrophages

doi: 10.3389/fmicb.2022.1017696

Figure Lengend Snippet: Autophagy regulation by Sirtuin 1 (SIRT1) and interferon gamma (IFN-γ) or CD154 at different time points. RAW 264.7 macrophages were either infected with RH tachyzoites at a ratio of 5:1 (parasite/host cell) for 2 h or left in the culture plate without infection, followed by incubation with SRT1720 (5 μM), EX527 (10 μM), or rapamycin (100 nM) for 2, 18, or 24 h before collection of the cell lysates or followed by incubation with rapamycin (100 nM) for 24 h for light microscopy or 12 h before transmission electron microscopy (TEM). We adjusted the protein concentration of each group of samples to be consistent and then carried out the experiment. Anti-LC3 I/LC3 II antibody, anti-phospho-mTOR (mechanistic target of rapamycin kinase) antibody, anti-mTOR, and anti-beta-Actin antibody were used at a 1:1,000 dilution. (A) The LC3 II/LC3 I ratio in the Toxoplasma gondii infection group increased over time compared to that for the negative control. Infected macrophages treated with SRT1720 showed a downregulation of LC3II/LC3 I at 2, 18, and 24 h compared to that for the T. gondii infection group. Infected macrophages treated with EX527 showed an upregulation of LC3II/LC3 I at 2, 18, and 24 h compared to that for the T. gondii infection group. (B) Infected macrophages treated with rapamycin showed an upregulation of LC3 II/LC3 I ratio at 2 and 18 h compared to that for the T. gondii infection group. (C) A scattered distribution chart showing the means of the intracellular tachyzoite counts. Values represent actual numbers (scattered dots) and means (black line) from two independent experiments; in each case, at least 200 infected cells were counted. (D) Observation under the light microscope showed that the infected macrophages had much heavier intracellular tachyzoite burdens than infected macrophages incubated with rapamycin at 24 h after infection. (E) Observation under TEM revealed that the infected macrophages had much heavier intracellular tachyzoite burdens than infected macrophages incubated with rapamycin at 12 h after infection. At the same time, host cells showed a large number of autophagosomes after being incubated with rapamycin for 12 h. These results were obtained from three independent experiments. Autophagosomes are multilayered structures containing cytoplasmic organelles. The arrows indicate the tachyzoites inside or outside host cells. The box indicates the autophagosome inside host cells. The values shown are the means ± SEM from three independent experiments. The arrows indicate the tachyzoites inside host cells. The box indicates the autophagosome inside host cells. (F) When infected by RH tachyzoites at two different time points, the mouse macrophages displayed an increased phosphorylation level of mTOR at 2 h and a decrease at 18 h. Infected macrophages treated with rapamycin showed a decrease in the mechanistic target of rapamycin kinase (mTOR) phosphorylation level at 2 and 18 h. At the same time, infected macrophages treated with rapamycin showed a downregulation of SIRT1 at 2 and 18 h compared to that of the infection-only group. Infected macrophages treated with SRT1720 or EX527 showed no significant changes of mTOR or phosphorylation level of mTOR compared to that of the infection-only group. p-mTOR, phosphorylated mTOR. t-mTOR, total mTOR. (G) The LC3 II/LC3 I ratio in the T. gondii infection group increased over time compared to that of the control group. Infected macrophages treated with IFN-γ showed an upregulation of LC3II/LC3 I at 2, 18, and 24 h compared to that for the T. gondii infection group. Infected macrophages treated with CD154 showed an upregulation of LC3II/LC3 I at 2 h and 18 h, but not at 24 h compared to the T. gondii infection group. These results were obtained from three independent experiments. RH, T. gondii RH strain. * P < 0.05, ** P < 0.01, and *** P < 0.001.

Article Snippet: The following reagents and equipments were used in the studies: SRT1720 (hydrochloride) (CAS No.: 1001645, MCE, USA), EX527 (CAS No.: 49843-98-3, MCE, USA), Rapamycin (CAS No.: 53123-88-9, MCE, USA), recombinant Interferon-γ (Cat. No.: I4777, Sigma-Aldrich, USA), recombinant mouse TRAP/CD40L protein (Active) (ab220551, Abcam, USA), anti-SIRT1 antibody [SirT1 (1F3) Mouse mAb #8469, Cell Signaling Technology, USA], anti-LC3 antibody [LC3A/B (D3U4C) XP Rabbit mAb #12741, Cell Signaling Technology, USA], anti-mTOR antibody [mTOR (7C10) Rabbit mAb #2983, Cell Signaling Technology, USA], anti-Phospho-mTOR antibody [Phospho-mTOR (Ser2448) (D9C2) XP Rabbit mAb #5536, Cell Signaling Technology, USA], anti-IRGM1 antibody [IRGM (E6P7W) Rabbit mAb #71950, Cell Signaling Technology, USA], anti-beta-Actin mouse monoclonal antibody (Cat. No.: T0022, Affinity, China), LysoTrackerTM Red DND-99–Special Packaging (Cat. No.: L7528, Thermo Fisher, USA), ProLong Gold Antifade Mountant with DAPI (Cat. No.: P36935, Thermo Fisher, USA), Goat anti-Mouse Alexa Fluor 488 (Cat. No.: A-11017, Thermo Fisher, USA), microplate reader (Sunrise, TECAN, Switzerland), Confocal Microscope (LSM 710, Zeiss, Germany), and Transmission Electron Microscope (TEM) (HT7800, Hitachi, Japan).

Techniques: Infection, Incubation, Light Microscopy, Transmission Assay, Electron Microscopy, Protein Concentration, Negative Control, Phospho-proteomics, Control